MEME version 3.0 (Release date: 2001/03/03 12:02:21)
For further information on how to interpret these results or to get a copy of the MEME software please access http://meme-suite.org.
This file may be used as input to the MAST algorithm for searching sequence databases for matches to groups of motifs. MAST is available for interactive use and downloading at http://meme-suite.org.
If you use this program in your research, please cite:
Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.
DATAFILE= lipocalin.s ALPHABET= ACDEFGHIKLMNPQRSTVWY Sequence name Weight Length Sequence name Weight Length ------------- ------ ------ ------------- ------ ------ ICYA_MANSE 1.0000 189 LACB_BOVIN 1.0000 178 BBP_PIEBR 1.0000 173 RETB_BOVIN 1.0000 183 MUP2_MOUSE 1.0000 180
This information can also be useful in the event you wish to report a problem with the MEME software. command: meme lipocalin.s -mod oops -protein -nmotifs 3 model: mod= oops nmotifs= 3 evt= inf object function= E-value of product of p-values width: minw= 8 maxw= 50 minic= 0.00 width: wg= 11 ws= 1 endgaps= yes nsites: minsites= 5 maxsites= 5 wnsites= 0.8 theta: prob= 1 spmap= pam spfuzz= 120 em: prior= dmix b= 0 maxiter= 50 distance= 1e-05 data: n= 903 N= 5 sample: seed= 0 seqfrac= 1 Dirichlet mixture priors file: prior30.plib Letter frequencies in dataset: A 0.072 C 0.029 D 0.069 E 0.078 F 0.043 G 0.058 H 0.025 I 0.048 K 0.086 L 0.087 M 0.018 N 0.053 P 0.032 Q 0.029 R 0.031 S 0.059 T 0.048 V 0.070 W 0.017 Y 0.050 Background letter frequencies (from dataset with add-one prior applied): A 0.072 C 0.029 D 0.068 E 0.077 F 0.043 G 0.057 H 0.026 I 0.048 K 0.086 L 0.087 M 0.018 N 0.053 P 0.033 Q 0.029 R 0.031 S 0.059 T 0.048 V 0.069 W 0.017 Y 0.050
BL MOTIF 1 width=19 seqs=5 ICYA_MANSE ( 14) PVNDFDLSAFAGAWHEIAK 1 BBP_PIEBR ( 13) PVDNFDWSNYHGKWWEVAK 1 RETB_BOVIN ( 11) VKENFDKARFAGTWYAMAK 1 LACB_BOVIN ( 22) TMKGLDIQKVAGTWYSLAM 1 MUP2_MOUSE ( 24) TGRNFNVEKINGEWHTIIL 1 //
log-odds matrix: alength= 20 w= 19 n= 813 bayes= 7.33628 E= 8.9e-006 -93 -241 -296 -256 -247 -224 -228 -113 -258 -190 -106 -229 361 -141 -151 -73 242 71 -330 -325 -63 -187 -232 -163 -140 75 -134 22 37 -77 241 -166 -172 -51 -40 -100 -53 221 -226 -208 -71 -310 103 103 -254 -142 -60 -205 81 -207 -94 124 -126 52 201 -34 -50 -195 -285 -234 -242 -375 92 -196 -382 91 -98 -352 -243 -408 -311 349 -242 -122 -182 -80 -157 -389 -397 -351 -318 -290 -467 -456 425 -423 -363 -172 -484 -47 -115 -430 -331 -373 -362 -296 -352 -245 -202 -103 -301 -418 363 -117 -408 -310 -244 -367 -403 -415 -323 -21 -370 -260 -284 -260 -313 -381 -414 -410 -107 -180 -350 -287 -106 -249 -200 251 -5 95 46 -249 -221 -152 -148 -153 -77 137 217 -191 96 -298 -78 114 -258 -152 -75 -202 -65 -209 -96 -73 -125 216 7 200 -40 -190 -293 -244 64 -339 -187 -114 -314 -206 -99 -238 222 -242 -133 101 -185 18 221 -102 -106 -240 -310 -282 -180 -226 -378 -340 342 -310 -122 98 -351 -88 -39 -305 -258 -227 -212 -200 -176 43 -146 170 273 -215 -127 -140 -272 -123 196 -223 -154 -247 -141 118 -194 -56 -71 -37 -96 -174 -321 -276 -198 -392 -300 -366 -445 397 -328 -418 -373 -473 -335 -252 -325 -311 -239 -220 -319 -402 -398 -452 89 -295 -91 104 -246 -153 -67 -184 77 -196 -82 -70 -123 52 29 -26 223 -176 -280 -234 -388 -388 -438 -441 -134 -384 -353 -366 -445 -246 -240 -397 -380 -303 -275 -375 -362 -359 569 -207 -290 -318 -383 -376 74 -360 354 -251 -386 -230 -173 -259 -307 -176 -201 -252 -277 -283 285 292 106 -271 -97 173 -260 -150 -93 -197 -87 -214 -101 -85 -134 26 -13 137 156 -183 -299 -255 -245 -306 -430 -410 -197 -384 -360 356 -396 52 173 -359 -346 -288 -286 -287 -197 121 -336 -320 328 -140 -376 -329 -260 -140 -310 73 -352 -200 -114 -318 -308 -242 -222 -45 -138 -73 -332 -364 -191 -312 -315 -227 -234 -288 -184 -127 276 37 218 -223 -256 -77 45 -195 -163 -176 -307 -303
letter-probability matrix: alength= 20 w= 19 n= 813 E= 8.9e-006 0.037648 0.005501 0.008765 0.013021 0.007819 0.012183 0.005337 0.021760 0.014270 0.023208 0.008862 0.010843 0.397695 0.011040 0.010997 0.035380 0.255507 0.113151 0.001765 0.005249 0.046148 0.008025 0.013645 0.024875 0.016458 0.096406 0.010301 0.055614 0.110953 0.050677 0.097771 0.016767 0.009858 0.020610 0.023801 0.029318 0.033050 0.320302 0.003617 0.011804 0.043768 0.003408 0.139637 0.157518 0.007437 0.021402 0.017205 0.011549 0.150282 0.020596 0.009613 0.125451 0.013591 0.041992 0.126344 0.046274 0.033756 0.017918 0.002407 0.009853 0.013340 0.002176 0.128895 0.019792 0.003065 0.108033 0.013208 0.004162 0.015830 0.005120 0.002130 0.596897 0.006075 0.012544 0.008899 0.033645 0.016038 0.004677 0.001109 0.004364 0.007897 0.003917 0.002680 0.003261 0.825220 0.003049 0.002105 0.014496 0.002983 0.062366 0.008294 0.002695 0.003269 0.002197 0.002554 0.007506 0.004168 0.012667 0.004284 0.024393 0.008872 0.001618 0.843839 0.034226 0.002560 0.006677 0.004782 0.003736 0.005249 0.004866 0.001963 0.045950 0.002506 0.004824 0.004397 0.009659 0.005427 0.004957 0.000981 0.002912 0.034158 0.008398 0.006029 0.010539 0.020783 0.010237 0.006517 0.271739 0.082408 0.167783 0.025414 0.009464 0.007008 0.010200 0.011270 0.020324 0.027943 0.178674 0.077865 0.013246 0.139154 0.003705 0.039637 0.169215 0.007267 0.020045 0.015457 0.011745 0.054561 0.020311 0.009476 0.032113 0.013669 0.130645 0.033095 0.233639 0.036218 0.018570 0.002276 0.009201 0.111703 0.002786 0.018702 0.034797 0.004921 0.013734 0.013134 0.009141 0.399576 0.016168 0.007306 0.106564 0.009040 0.033103 0.145351 0.028873 0.022907 0.013104 0.002023 0.007067 0.020475 0.006103 0.004954 0.007296 0.465058 0.006699 0.011153 0.094150 0.007527 0.046967 0.014044 0.006431 0.005439 0.006065 0.007205 0.014673 0.014079 0.093289 0.006305 0.162088 0.474242 0.006597 0.028236 0.029163 0.006587 0.024524 0.100914 0.010144 0.029454 0.015659 0.006915 0.120434 0.008452 0.019893 0.019239 0.045115 0.024453 0.020764 0.001875 0.007340 0.018080 0.001931 0.008523 0.006103 0.001978 0.898946 0.002679 0.002630 0.006445 0.003277 0.001808 0.009277 0.003409 0.003397 0.006001 0.012759 0.005207 0.004284 0.001098 0.002167 0.132127 0.003792 0.036446 0.158523 0.007898 0.019837 0.016307 0.013317 0.146270 0.022232 0.010409 0.032682 0.013896 0.041836 0.038534 0.048888 0.224220 0.020422 0.002492 0.009872 0.004843 0.001992 0.003278 0.003609 0.017084 0.003997 0.002255 0.003771 0.003911 0.015805 0.003499 0.003387 0.002340 0.003593 0.004663 0.004356 0.003890 0.005749 0.896136 0.011843 0.009595 0.003235 0.004805 0.005679 0.072166 0.004720 0.302602 0.008347 0.005911 0.017649 0.005569 0.008799 0.003868 0.008653 0.007805 0.010215 0.006998 0.009772 0.125254 0.378358 0.149280 0.004467 0.034739 0.254975 0.007168 0.020366 0.013608 0.012130 0.046891 0.019644 0.009145 0.029472 0.012858 0.035034 0.028705 0.151252 0.140126 0.019446 0.002175 0.008519 0.013123 0.003519 0.003461 0.004471 0.011097 0.004013 0.002139 0.563637 0.005489 0.124417 0.061137 0.004401 0.002947 0.003962 0.004313 0.007984 0.012184 0.160598 0.001691 0.005416 0.696958 0.011057 0.005051 0.007864 0.007129 0.021780 0.003024 0.078866 0.007471 0.021665 0.008337 0.005850 0.003845 0.005473 0.006750 0.042869 0.018347 0.041929 0.001740 0.003994 0.018990 0.003357 0.007668 0.015921 0.008558 0.007816 0.007252 0.019764 0.578991 0.111958 0.083502 0.011287 0.005527 0.017179 0.043000 0.015133 0.015396 0.020540 0.002070 0.006090
Time 1.04 secs.
BL MOTIF 2 width=20 seqs=5 ICYA_MANSE ( 100) NLVPWVLATDYKNYAINYNC 1 BBP_PIEBR ( 96) ENVFNVLSTDNKNYIIGYYC 1 RETB_BOVIN ( 101) NDDHWIIDTDYETFAVQYSC 1 MUP2_MOUSE ( 105) FNTFTIPKTDYDNFLMAHLI 1 LACB_BOVIN ( 105) ENKVLVLDTDYKKYLLFCME 1 //
log-odds matrix: alength= 20 w= 20 n= 808 bayes= 7.32733 E= 1.3e-004 -116 -324 -64 181 136 -144 -82 -221 -110 -238 -136 235 -162 0 -39 -57 -86 -222 -289 -199 -264 -361 -4 -243 -347 -231 -89 -277 -263 -94 -248 377 -263 -136 -183 -110 -174 -332 -348 -353 -66 -251 55 -62 -218 -174 -92 -65 47 -162 -65 -95 -142 12 -3 -58 128 212 -277 -241 -126 -208 -290 -239 294 -248 179 -55 -244 -93 -23 -219 151 -123 -126 -139 -115 66 -140 111 -163 -256 -286 -240 -117 -258 -187 -104 -233 -2 -61 22 -239 -123 -124 -153 70 -128 496 -172 -187 -259 -460 -433 -253 -411 -393 294 -445 -100 -72 -409 -350 -346 -317 -333 -179 284 -423 -403 -241 -288 -462 -384 -125 -379 -303 115 -384 294 55 -375 98 -219 -226 -288 -207 -90 -286 -303 87 -310 199 -26 -267 -139 -74 -219 69 -226 -114 -38 -135 29 -2 118 -60 -209 -302 -248 -207 -284 -375 -406 -362 -318 -321 -234 -360 -351 -189 -221 -300 -234 -236 -21 413 -235 -394 -430 -314 -425 368 -126 -416 -331 -261 -375 -424 -423 -332 -101 -381 -278 -298 -284 -333 -389 -419 -420 -225 -294 -274 -298 79 -283 -38 -226 -307 -220 -157 120 -267 -192 -179 -191 -229 -254 -84 364 -140 -422 109 152 -378 -212 -152 -292 227 -299 -190 -123 -188 11 -34 -125 -141 -275 -395 -345 -219 -352 -147 -205 -340 -210 -87 -272 -8 -326 -217 360 -237 -84 -81 -94 66 -308 -341 -333 -252 -295 -377 -356 284 -344 -34 -222 -366 -206 -151 -294 -288 -226 -210 -233 -263 -256 -55 339 187 -211 -422 -353 -120 -290 -268 186 -351 201 34 -320 -273 -212 -215 -199 -130 -4 -258 -258 -245 -306 -430 -410 -197 -384 -360 356 -396 52 173 -359 -346 -288 -286 -287 -197 121 -336 -320 101 -261 -102 -53 108 107 -47 -151 -62 -172 -64 119 -120 207 16 -25 -39 -150 -255 -163 -159 113 -291 -265 139 -272 185 -163 -283 -165 -93 -236 -215 -167 -141 -152 -187 -189 -63 335 -70 -186 -203 -142 -27 -188 -50 -16 -146 73 243 97 -158 -34 -48 101 -41 -46 -169 156 -296 492 -486 -201 -375 -433 -397 -94 -465 -327 -236 -427 -408 -348 -325 -347 -285 -273 -475 -467
letter-probability matrix: alength= 20 w= 20 n= 808 E= 1.3e-004 0.032008 0.003091 0.043880 0.270369 0.111568 0.021231 0.014687 0.010339 0.039904 0.016638 0.007179 0.270043 0.010552 0.029256 0.023973 0.039284 0.026211 0.014867 0.002331 0.012589 0.011450 0.002401 0.066534 0.014318 0.003909 0.011552 0.014042 0.006973 0.013808 0.045272 0.003312 0.726528 0.005234 0.011368 0.008820 0.027339 0.014303 0.006960 0.001554 0.004324 0.045251 0.005136 0.099769 0.049888 0.009538 0.017240 0.013704 0.030460 0.118766 0.028112 0.011727 0.027391 0.012135 0.031892 0.030823 0.039152 0.115493 0.301591 0.002541 0.009392 0.029934 0.006911 0.009133 0.014670 0.332829 0.010301 0.090048 0.032519 0.015765 0.045539 0.015711 0.011656 0.092276 0.012458 0.013088 0.022310 0.021474 0.109455 0.006588 0.107334 0.023030 0.004946 0.009422 0.014560 0.019318 0.009618 0.007125 0.023162 0.017027 0.085376 0.012045 0.061630 0.006208 0.012490 0.013307 0.020257 0.077420 0.028644 0.539262 0.015151 0.019524 0.004853 0.002817 0.003837 0.007481 0.003333 0.001707 0.365109 0.003926 0.043264 0.011190 0.003119 0.002882 0.002667 0.003484 0.005829 0.013773 0.497223 0.000923 0.003058 0.013417 0.003965 0.002769 0.005369 0.018159 0.004139 0.003187 0.105761 0.005997 0.664352 0.027015 0.003938 0.064037 0.006423 0.006558 0.007970 0.011357 0.037092 0.002389 0.006106 0.130922 0.003407 0.270564 0.064021 0.006814 0.021865 0.015590 0.010435 0.137674 0.018102 0.008363 0.040899 0.012728 0.035797 0.031068 0.132991 0.031416 0.016267 0.002144 0.008934 0.017077 0.004075 0.005057 0.004623 0.003535 0.006314 0.002802 0.009391 0.007043 0.007620 0.004986 0.011481 0.004052 0.005781 0.006120 0.050675 0.832113 0.013602 0.001127 0.002525 0.008139 0.001535 0.873188 0.032034 0.002430 0.005774 0.004248 0.003537 0.004519 0.004622 0.001844 0.026334 0.002312 0.004257 0.003983 0.008174 0.004732 0.004687 0.000947 0.002703 0.014990 0.003804 0.010209 0.009730 0.074757 0.008093 0.020011 0.009966 0.010205 0.018869 0.006196 0.122202 0.005112 0.007713 0.009088 0.015562 0.009739 0.011934 0.009679 0.622142 0.027180 0.001567 0.145409 0.220364 0.003145 0.013192 0.009039 0.006306 0.411729 0.010929 0.004942 0.022649 0.008858 0.031479 0.024750 0.024543 0.017955 0.010291 0.001120 0.004554 0.015679 0.002549 0.024718 0.018622 0.004114 0.013434 0.014186 0.007243 0.080917 0.009062 0.004102 0.644220 0.006273 0.016301 0.017863 0.030405 0.075495 0.008221 0.001627 0.004969 0.012490 0.003782 0.004999 0.006533 0.311220 0.005292 0.020581 0.010241 0.006786 0.020735 0.006474 0.006937 0.004429 0.006107 0.007312 0.011667 0.007686 0.011774 0.011802 0.523153 0.261687 0.006758 0.003650 0.006646 0.018855 0.007670 0.004061 0.173482 0.007529 0.349203 0.023390 0.005783 0.004898 0.006730 0.007085 0.014687 0.019305 0.067370 0.002891 0.008320 0.013123 0.003519 0.003461 0.004471 0.011097 0.004013 0.002139 0.563637 0.005489 0.124417 0.061137 0.004401 0.002947 0.003962 0.004313 0.007984 0.012184 0.160598 0.001691 0.005416 0.143897 0.004796 0.033739 0.053310 0.091558 0.120306 0.018800 0.016682 0.055672 0.026293 0.011807 0.121340 0.014186 0.123220 0.035201 0.049209 0.036293 0.024574 0.002968 0.016149 0.023811 0.063840 0.009090 0.012295 0.113437 0.008693 0.094037 0.015423 0.012067 0.027627 0.009638 0.010374 0.007336 0.009197 0.011843 0.020453 0.013020 0.018662 0.011229 0.507930 0.043881 0.008037 0.016679 0.028677 0.035909 0.015637 0.018373 0.042632 0.031185 0.143414 0.099065 0.103743 0.010902 0.023069 0.022578 0.117731 0.035868 0.050564 0.005357 0.146699 0.009178 0.885360 0.002350 0.019074 0.003228 0.002854 0.001658 0.024777 0.003400 0.009005 0.003589 0.002760 0.001926 0.002623 0.003308 0.005279 0.006605 0.010428 0.000645 0.001953
Time 1.47 secs.
BL MOTIF 3 width=18 seqs=5 MUP2_MOUSE ( 59) FLEQIHVLEKSLVLKFHT 1 ICYA_MANSE ( 128) HSIHAWILSKSKVLEGNT 1 BBP_PIEBR ( 124) HQDFVWVLSRSKVLTGEA 1 RETB_BOVIN ( 36) FLQDNIVAEFSVDENGHM 1 LACB_BOVIN ( 152) FDKALKALPMHIRLSFNP 1 //
log-odds matrix: alength= 20 w= 18 n= 818 bayes= 7.34518 E= 1.2e+002 -356 -356 -440 -445 360 -395 350 -258 -427 -226 -191 -316 -358 -249 -262 -312 -324 -305 -82 63 -69 -284 84 -24 -219 -147 -63 -149 -65 134 -62 -59 -123 214 12 116 -45 -158 -271 -221 -72 -328 98 131 -265 -163 -76 105 76 -211 -98 -82 -128 220 11 -49 -60 -195 -298 -247 71 -277 65 -47 99 -150 250 -173 -63 -180 -70 -56 -120 215 22 -34 -46 -170 -234 -51 68 -177 -342 -281 -121 -247 -203 236 -279 75 33 59 -220 -154 -152 -150 -75 170 -224 -212 -141 -265 -244 -175 -116 -232 175 98 42 -144 -64 -173 -207 -42 -4 -133 -112 -135 449 -110 11 -214 -387 -353 -251 -342 -291 134 -380 -154 -102 -357 -264 -275 -224 -267 -119 327 -380 -402 11 -293 -461 -384 -138 -354 -314 -36 -386 309 44 -379 -291 -224 -230 -268 -216 -115 -300 -319 -96 -337 -65 195 -316 -171 -125 -253 -117 -262 -155 -91 215 10 -54 207 -85 -236 -355 -302 -132 -302 -217 -136 105 -220 -107 -166 221 -190 230 -143 -192 3 217 -114 -105 -183 -281 -218 -137 -246 -231 -280 -303 -216 152 -307 -260 -336 -220 -124 -230 -176 -152 352 81 -324 -355 -310 -122 -196 -348 -279 -130 -265 -212 221 130 100 24 -255 -236 -148 -130 -169 -93 145 -242 -229 -82 -224 -28 -176 -246 -260 -191 13 -196 -173 -101 -213 -210 -112 92 -171 -94 311 -336 -333 -257 -317 -366 -34 -145 -376 -293 -49 -335 311 44 -349 -283 -186 -199 -286 -226 -133 -303 -318 -61 -290 -84 89 -239 -134 -52 -191 75 -197 -82 123 -117 53 29 134 145 -184 -273 -222 -188 -343 -328 -380 240 348 -270 -306 -387 -326 -253 -265 -315 -287 -255 -208 -268 -315 -281 -187 -179 -348 -75 74 -294 -152 363 -312 -163 -307 -203 241 -200 -16 -67 -77 -127 -308 -328 -217 94 -202 -240 -183 -193 -189 -164 -82 -186 -143 244 -162 213 -72 -88 -16 269 -93 -268 -252
letter-probability matrix: alength= 20 w= 18 n= 818 E= 1.2e+002 0.006081 0.002485 0.003227 0.003521 0.524935 0.003723 0.294451 0.007980 0.004452 0.018070 0.004884 0.005929 0.002720 0.005205 0.005113 0.006744 0.005063 0.008392 0.009807 0.077217 0.044364 0.004099 0.122591 0.065047 0.009508 0.020693 0.016794 0.016958 0.054726 0.219610 0.011961 0.035373 0.013850 0.128524 0.034140 0.130314 0.034809 0.023236 0.002656 0.010747 0.043525 0.003007 0.135076 0.190510 0.006881 0.018595 0.015392 0.098740 0.144497 0.020033 0.009351 0.030171 0.013395 0.134647 0.034017 0.041547 0.031465 0.017979 0.002195 0.008978 0.116613 0.004303 0.106973 0.055462 0.086279 0.020274 0.147413 0.014401 0.055315 0.024957 0.011360 0.035936 0.014112 0.129452 0.036516 0.046294 0.034558 0.021410 0.003426 0.034946 0.114267 0.008562 0.006373 0.010972 0.018716 0.010393 0.006385 0.245069 0.012418 0.145730 0.023072 0.080132 0.007067 0.010046 0.010978 0.020619 0.028362 0.225686 0.003660 0.011494 0.026978 0.004647 0.012562 0.022916 0.019425 0.011461 0.087303 0.093998 0.114768 0.032011 0.011827 0.016012 0.007725 0.021901 0.030487 0.023252 0.021909 0.027229 0.390373 0.023216 0.076974 0.006631 0.004672 0.006673 0.007600 0.005349 0.003455 0.120557 0.006143 0.029791 0.009063 0.004482 0.005218 0.004337 0.006660 0.009194 0.020826 0.668049 0.001248 0.003077 0.077273 0.003833 0.002798 0.005358 0.016607 0.004930 0.002954 0.037170 0.005887 0.738688 0.025054 0.003828 0.004338 0.006203 0.006400 0.009099 0.010656 0.031297 0.002160 0.005466 0.036647 0.002835 0.043369 0.297987 0.004857 0.017507 0.010937 0.008268 0.037961 0.014088 0.006306 0.028278 0.143873 0.031430 0.021590 0.246399 0.026533 0.013495 0.001485 0.006157 0.028576 0.003595 0.015146 0.029979 0.089976 0.012532 0.012350 0.015081 0.396978 0.023178 0.090574 0.019670 0.008613 0.029777 0.141343 0.026547 0.023098 0.019534 0.002475 0.010978 0.027726 0.005313 0.013740 0.011015 0.005303 0.012810 0.074620 0.005664 0.014139 0.008466 0.004008 0.022471 0.006616 0.008663 0.010919 0.670344 0.083569 0.007326 0.001484 0.005803 0.030695 0.007530 0.006117 0.011131 0.017578 0.009122 0.005993 0.220376 0.211453 0.173241 0.021747 0.009090 0.006333 0.010507 0.012760 0.018124 0.025050 0.189682 0.003250 0.010220 0.040589 0.006172 0.056063 0.022680 0.007866 0.009464 0.006932 0.052284 0.022058 0.026167 0.009146 0.012141 0.007608 0.013420 0.059535 0.017886 0.024791 0.598543 0.001684 0.004972 0.012022 0.003248 0.005396 0.060794 0.015895 0.004251 0.003405 0.033952 0.008400 0.749174 0.025007 0.004710 0.004572 0.008073 0.007912 0.008044 0.009937 0.027586 0.002116 0.005505 0.046781 0.003907 0.038043 0.142536 0.008253 0.022677 0.018086 0.012647 0.143644 0.022067 0.010407 0.124330 0.014421 0.042345 0.038480 0.148474 0.130260 0.019378 0.002605 0.010661 0.019455 0.002715 0.007040 0.005518 0.229289 0.641445 0.004005 0.005735 0.005871 0.009036 0.003191 0.008432 0.003650 0.003992 0.005379 0.013862 0.007456 0.007802 0.002479 0.013647 0.020610 0.002616 0.040582 0.128857 0.005659 0.020053 0.321706 0.005492 0.027590 0.010317 0.004518 0.282932 0.008106 0.026192 0.019685 0.034217 0.019793 0.008215 0.001781 0.011078 0.137648 0.007194 0.012935 0.021570 0.011374 0.015531 0.008361 0.026917 0.023613 0.032221 0.100110 0.017268 0.142155 0.017699 0.017053 0.052513 0.308143 0.036319 0.002706 0.008668
Time 1.83 secs.
CPU: nbcr2
MOTIFS
For each motif that it discovers in the training set, MEME prints the following information:
Multilevel TTATGTGAACGACGTCACACT consensus AA T A G A GA AA sequence T C TT T
You can convert these blocks to PSSMs (position-specific scoring matrices), LOGOS (color representations of the motifs), phylogeny trees and search them against a database of other blocks by pasting everything from the "BL" line to the "//" line (inclusive) into the Multiple Alignment Processor. If you include the -print_fasta switch on the command line, MEME prints the motif sites in FASTA format instead of BLOCKS format.